Document Type : Original Article
Authors
1 Department of Anatomical Sciences, School of Medicine, Iran University of Medical Sciences, Tehran, Iran
2 Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran;Department of Biochemistry, School of Medicine, Iran University of Medical Sciences, Tehran, Iran
3 4Anatomical Sciences Department, School of Medicine, Tarbiat Modares University, Tehran, Iran
4 Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran;6Pediatric Neuro-Rehabilitation Research Center, The University of Social Welfare and Rehabilitation Sciences, Tehran, Iran
5 8Department of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
6 7School of Behavioral Sciences and mental Health, Tehran Psychiatry Institute, Iran University of Medical Sciences, Tehran, Iran
7 Department of Anatomical Sciences, School of Medicine, Iran University of Medical Sciences, Tehran, Iran;Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran
Abstract
Keywords
Infertility is one of the most serious social problems that
has an effect on a huge percentage of couples. In general,
the basic cause of infertility refers to the male partner
in approximately 40-45% of cases (
The activity of the opioid system is mediated by
endogenous opioid peptides (EOPs). EOPs or opiate
alkaloids carry out their function through three types
of opioid receptors [the delta-opioid receptor (DOR),
the mu opioid receptor (MOR) and the kappa opioid
receptor (KOR)] on membranes (
The effect of opiates on spermatozoa in some aspects
is still unknown or controversial. Some studies have
been performed on the effect of certain drug abuse on
the human and mouse sperm parameters (
Sperm motility is considered a key functional parameter
that controls reproduction (
Since decreased motility (asthenozoospermia) is a
common abnormality among opiate drug addicts (
In this case-control study, participants were interviewed after written informed consent. The data on personal information (e.g. name, age, marital and parental status), history of addiction [duration of heroin consumption, heroin use (mg/day), cigarette smoking, and alcohol drinking], and medical status (e.g. medications, special illness and surgery) were obtained via a structured questionnaire.
Based on the medical files and questionnaires, twentyfour 20-50-year-old men with normal body mass index (BMI) who just used heroin for at least 12 months -without using other drugs during that interval- were selected as a case or heroin-addicted group. They were introduced from addiction treatment centers before entering treatment programs and should have met the Diagnostic and Statistical Manual of Mental Disorders (DSM-V) criteria for addiction.
Also, 24 age-BMI-matched men with a normal semen analysis according to World Health Organization (WHO) 2010 criteria volunteered to participate in this study as a control group. They were male partners of married couples without any illicit drug use who had attended the Shahid Akbar-Abadi Obstetrics and Gynecology Hospital of the Iran University of Medical Science for female infertility consultation
Subjects with medical problems known to be associated with subfertility in both groups, illicit-drug usersin control group, and individuals that started treatment with other drugs in addicted ones were excluded from the study.
Semen samples were obtained from donors by
masturbation after 2 to 3 days of abstinence into sterile
containers and allowed to liquefy at 37˚C for 30 minutes
before processing. Semen volume, as well as sperm
concentration, viability (by eosin B staining), morphology
(by Papanicolaou staining method), and motility were
measured in each sample by CASA (
For eosin B staining (0.5% in saline), 20 microliters
the sperm suspension was mixed with 7 µl eosin and
observed under a light microscope (×400 magnification).
Then, 200 sperm were counted and the percentage of live
spermatozoa was recorded. With the staining, red sperm
heads were considered as dead (
Sperm morphology was assayed by the Papanicolaou
method. First, smears were prepared and stained with
the Papanicolaou method based on the protocol. Then,
the morphology of 200 spermatozoa was surveyed under ×1000 oil immersion lens. With the staining, the
nuclei turn blue, and the acrosome and tail become pink.
Abnormal morphology wasreported in five fields of vision
randomly, and the percentage of abnormal morphology
was recorded (
Before RNA extraction or flow cytometry, spermatozoa were isolated from semen on cook medical gradient (40-80%), followed by a swim-up in washing medium supplemented by Albumin 10% to recover motile cells without any contaminant leukocytes or other debris, and then they were visually examined under a light microscope.
All primers (
Sequences of the designed primers used for real-time quantitative polymerase chain reaction
Gene | Primer sequence (5ˊ-3ˊ) |
---|---|
F: CCACCTTTCTGACATTGCC | |
R: CAGGGGCCTGTACGTTTTTA | |
F: GCCTCAGCCGAACCTACAAG | |
R: AGTTTGCACAACGTCTCCAAG | |
F: GCAAGCAGGAGTATGACGA | |
R: CAAATAAAGCCATGCCAATC | |
The RNA of spermatozoa was isolated with the RNeasy Mini kit (Qiagen, Germany). First strand cDNA synthesis was carried out using QuantiNova Reverse Transcription Kit (Qiagen, Germany). Then real-time quantitative polymerase chain reaction (qPCR) was performed using QuantiNova SYBR Green PCR Kit (Qiagen, Germany).
The thermal cycling program included an initial
incubation at 95˚C for 2 minutes, followed by 60 cycles
of 95˚C for 5 seconds and 60˚C for 30 seconds. Three
replicates of each reaction were performed, and the cycle
threshold (Ct) values were averaged. Expression values
were normalized to the average expression of the housekeeping gene (
Flow cytometry was performed on a BD Biosciences FACSCalibur in order to rate of presences of surface expression of enkephalinase and aminopeptidase on sperm cells. Sperm was stained directly for APN and NEP. Briefly, 1×106 sperm in 2 ml phosphate buffered saline (PBS, Sigma, USA) was centrifuged in 4˚C for 10 minutes (×300 g). The pellet was suspended in 100 µl washing medium and then was added 20 µl antibody [PE Mouse Anti-Human CD13 and PE Mouse Anti-Human CD10 (BD Biosciences USA)]. Samples were incubated at 4˚C for 1 hour. Next, sperm was centrifuged three times at 4˚C for 10 minutes (×300 g). Finally, the pellet was suspended in 300 µl PBS and analyzed using the flow cytometer.
Statistical analysis was done with statistical software (Ver. 16.0, Chicago, SPSS Inc.). The normal distribution was evaluated with the Kolmogorov-Smirnov test. The results were analyzed by performing independentsamples t test and Mann-Whitney U test. P≤0.05 was considered as statistically significant and mean ± SE was also calculated for each variable. The partial correlation and multiple regression analyses were done between APN and NEP levels and other parameters.
This study has been approved by the medical Ethics Committee of Iran University of Medical Science (code: IR. IUMS.rec.1394.9211313202). All human trails were carried out in accordance with the Declaration of Helsinki guidelines.
Twenty-four healthy and twenty-four men addicted to heroin participated in the study. The mean ages in addicted and control groups were 35.44 ± 1.3 years and 33.91 ± 1.79 respectively, which there was no significant difference in average age. Although the range of BMI was normal in both groups, this parameter in the addicted men (22.34 ± 0.38 kg/m2) was significantly lower than the healthy ones (28.69 ± 0.91 kg/m2) (P≤0.01). All subjects in the addicted group were smoker, so there was a statistical difference between groups in this case (P≤0 .01).
According to our data, although semen volume, sperm
concentration, and normal morphology were the same
between groups, there was a significant decrease in
sperm viability and motility rates in the addicted group
(
Sperm parameters in the study population
Parameters | Healthy men | Heroin addicted men | P value |
---|---|---|---|
Semen volume (ml) | 3.63 ± 0.42 | 3.22 ± 0.35 | 0.457 |
Sperm concentration (×106/ml) | 115.79 ± 16.5 | 113.51 ± 18.9 | 0.928 |
Sperm total motility (%) | 63.03 ± 3.31 | 41.07 ±3.63 | 0.0001 |
Sperm progressive motility (%) | 35.21 ± 2.64 | 20.93 ± 3.22 | 0.001 |
Sperm normal morphology (%) | 9.48 ± 1.54 | 12.11 ± 1.52 | 0.233 |
Sperm viability (%) | 86.81 ± 1.26 | 69.9 ± 4.69 | 0.002 |
Data are presented as mean ± SE.
As shown in the
Enkephalinase and aminopeptidase gene expression levels in healthy and heroin addicted men
Gene expression level | Healthy men | Heroin addicted men | P value |
---|---|---|---|
1.00 ± 0.67 | 0.36 ± 0.13 | 0.008 | |
1.07 ± 0.11 | 0.52 ± 0.12 | 0.002 | |
Data are presented as mean ± SE.
Figure 1 shows flow cytometry analysis of cell surface protein enkephalinase and aminopeptidase in sperm of healthy and addicted men. The results demonstrated that the mean APN/CD13 rate in the control group (63 ± 12) was significantly higher than addicted ones (24 ± 12) (P≤0.05), while NEP/CD10 ratio in the control (4.3 ± 1) and addicted (3.7 ± 2) group did not show a significant difference.
Flow cytometry analysis. It showed that the average percent aminopeptidase N (APN/CD13) in control group (63 ± 12%) significantly decreased compared to heroin addicted ones (24 ± 12%), while the average percent endopeptidase (NEP/CD10) in control (4.3 ± 1%) and addicted group (3.7 ± 2%) showed no significantly decrease.
As shown in
Correlation between motility and demographic data
Parameters | Unstandardized coefficients | Standardized coefficients | P value | |
---|---|---|---|---|
Beta | SE | Beta | ||
Age (Y) | 1.221 | 0.731 | 0.437 | 0.108 |
BMI (kg/m2) | -0.262 | 1.082 | -0.056 | 0.811 |
Duration of heroin consumption (Y) | -1.650 | 0.750 | -0.799 | 0.040 |
Heroin use (mg/day) | 1.821 | 2.468 | 0.134 | 0.468 |
Cigarette smoking | -0.427 | 10.109 | -0.448 | 0.658 |
BMI; Body mass index and SE; Standard error.
Partial correlation between duration of dependence and other studied parameters
Parameters | r-value | P value |
---|---|---|
Sperm viability (%) | -0.627 | 0.016 |
Sperm total motility (%) | -0.410 | 0.050 |
APN (2-∆∆Ct) | -0.641 | 0.002 |
NEP (2-∆∆Ct) | -0.434 | 0.049 |
Adjusted with cigarette smoking. APN; Aminopeptidase and NEP; Neutral endopeptidase.
The present study showed that enkephalin-degrading
enzymes (NEP and APN) and sperm viability and motility
were reduced in men addicted to heroin. We also showed
that there was a significant negative correlation between
Infertility is one of the most important problems of human societies throughout the world. Considering the role of recreational heroin consumption as an idiopathic etiology of male infertility and increasing consumption of illicit drugs, especially among young people of reproductive age, socio-medical studies on this issue has been done less yet. The living conditions, lack of cooperation, simultaneous use of various drugs and legal and ethical problems in sampling in addicted people make the research difficult and complicated in this area. Therefore, research in this area can be very valuable. Our findings suggest a remarkable association among heroin addiction, asthenozoospermia and decreased APN and NEP mRNA levels. In addition, the duration of drug dependence is one of the main factors contributing to the detrimental effects of heroin on impaired male fertility.
Decreased in heroin users BMI may be caused by caloric
malnutrition (
In this study, reduced sperm motility was observed in
addicted men. Our finding is in line with other studies
who mentioned that opioids such as heroin, kerack, and
morphine can impair sperm parameters in mice and human.
They also showed those alterations were dose-dependent
(
Reduced total and progressive sperm motility may be
caused directly by heroin because of alteration of the
encephalin-degrading enzymes. Researchers scrutinized
the presence of APN/CD13 in the sperm head, neck and
along the tail (
Notwithstanding the level of
Based on the literature, NEP is the main peptidase
that can hydrolyze tachykinins, which are present in
spermatozoa and interfere in the regulation of sperm
motility (
In addition, heroin can impair semen quality and
alter sperm microenvironment by semen acidification
and leukocytospermia (
The main limitation in the present study were: i. Sampling of heroin-addicted men was complicated because (a) heroin consumers usually take various addiction and narcotic drugs like opiate, kerack or methamphetamines, (b) the majority of addicted men had no trends to provide semen. Hence, we selected persons who used only heroin for at least 12 months -without using other drugs, ii. In addition; cigarette smoking was a major interference variable, which was controlled by partial correlation, iii. Scio-economic and family backgrounds were different among the participants. For example, diet may affect sperm parameters, and iv. We could not follow up the fertility status after treatment.
We conclude that semen quality and enkephalindegrading enzymes were decreased in heroin-addicted
men and there is a significant negative correlation
between